Wednesday, January 23, 2008

Rob's Paper Has Been Accepted!!

Rob's paper got rejected from the first journal he submitted it to: The Journal of Immunology. This was pretty sad for us. We got the rejection notice over Christmas break and it sounded pretty harsh to us. But perspective is a great thing. Rob showed the rejection to his professor, who's been around the block a few times. Retzinger's response to the rejection was that it was actually a pretty good rejection notice. They weren't attacking his research, they were just saying it wasn't important enough for their journal. As Retzinger says, "They probably think their own crap doesn't stink."

So Rob then submitted it, with minimal changes, to another journal: Experimental and Molecular Pathology. They accepted it within a week, and that's great! Rob has 2 requirements for graduation: write and defend his dissertation, and get a paper published. So, we're halfway there!

I've attached his paper for you to read if you want. Don't be worried about the technical science jargon, it's pretty read-able.

And congrats to Rob!

Tamra

ROB'S PAPER:

House Wives and House Cats:
Evidence That They are One and the Same


Robert I. Thacker
University of Cincinnati
Department of Pathology and Laboratory Medicine

Introduction

The behaviors and physical features exhibited by both house wives and house cats have long intrigued the science community. The behaviors were assumed to be coincidental, a result of thousands of years spent together in a similar environment, i.e., the principle dwelling place, but recent evidence suggests that there may be a much deeper cause to the observed similarities. Until this time these similarities have only been mentioned in passing. We felt that with the availability of DNA technology, and much more rigorous methodologies, it was time to approach this topic in greater depth. Herein we first present a thorough list of similarities between the two subjects. Second, through comparison of unique and newly discovered DNA sequences, we present undeniable evidence that house wives and house cats are the same species.

Materials and Methods

Reagents
The house cat was a gift from a local breeding colony, Schwegler Laboratories, (Cincinnati, OH). The house wife was acquired for a worthwhile fee, i.e., a ring, and a marriage vow. She is a product of Tungate Laboratories, (St. Louis, MO).

Observations of behavior and physical features
The comparative study was accomplished via direct observation. Potential similarities were recorded using digital imaging. Microscopy was used at a later time to analyze the pictures and detect the presence of any encrypted similarities.

DNA analysis
DNA was sequenced via Southern blot analysis.

Results and Discussion

Same gender and hair pattern

To begin, we made a list of all the observed similarities between the available house wife and house cat. Interestingly, one of the more prominent common features includes like gender. This link is further solidified through the fact that both test subjects exhibit hair on the top of their heads. In contrast, multiple males recruited for this study have an appreciable lack of hair in this location. Fig. 1. These observations provide a direct link between house wives and house cats and speak to the viability of our study. To our knowledge no other lab has commented on this obvious, yet important distinction.

A



B




















C




Figure 1. Physical comparison between house wives and house cats. A, house cat specimen. Notice hair on top of head as well as other features described in text. B, House wife specimen. Notice hair on top of head and other features similar to house cat as described in text. C, Male specimens. Notice distinct lack of hair on top of head in all three cases.




Similar physical features and behaviors

Figure 2. House wife and house cat napping. Though the house cat is awake, it was just asleep and though they are not curled up in this example, most often a curled up position is used for these naps.

These data clearly indicate that further comparisons need not be made between adult males and house cats, and thus our attention turns solely to house wives and house cats. Both groups exhibit ears, eyebrows, eyes, a nose, teeth, and a tongue, Fig. 1. Interestingly, both groups have four white limbs, each limb terminating in fingers and toes possessing “claws” at the end of each (data not shown). Also, both love taking naps in the middle of the day, Fig. 2, often, though not always, in a curled up position.

DNA Analysis

As a final test we wanted to compare the DNA of house wives and house cats. DNA was isolated according to typical protocol and was sequenced using Southern Blot analysis. A majority of DNA was unreadable, most likely a direct reflection of the inability of males to understand the basic language of house wives and house cats, but one sequence was clear and readable, and was present in both specimens, Fig. 3. We feel that this evidence undeniably indicates that both house wives and house cats are the same species, and that species is of feline origin.

A – ACATACATACATACATACATACATACATACATACATACAT
B – ACATACATACATACATACATACATACATACATACATACAT

Figure 3. Matching region of DNA strongly indicates that the two specimens are one and the same species. A, represents sequence of DNA discovered in the house wife. B, Complimentary sequence of DNA found in the house cat. Both were found on chromosome 16 in regions previously linked to physical appearance and behavior.

Conclusions and Future Directions

This work clearly demonstrates that house wives and house cats are truly one and the same. We feel that this work will open the door to many more studies regarding the link between two beings that have always been seen as similar, yet separate, species. Our study has closed the door on one perplexing chapter of this scientific endeavor, but has opened the door to many others, for example, women often refer to men as dogs. Perhaps this is closer to the truth than many may think. We would like to pursue this study utilizing the same rigorous methods that brought such clear results in the present study. After all, the evidence is astounding, from uncleanliness to drooling. We believe that the link between men and dogs will most likely be even stronger than the link between house wife and house cat.

No comments: