Rob's 30th Birthday Invitations

This was the inviation that got sent out for Rob's 30th bitthday party, 2008 (when he was really 29).

You’re Invited
to Rob’s 30th
Birthday Party!

To celebrate we’ll be enjoying
an adult-only evening on his birthday, Saturday, January 26th.
We will be dining at 6:00 p.m. at
Cancun Mexican Restaurant
(6383 Glenway Ave.).

If you need directions or if you have any questions,
please call us: 481-1029 or 505-4517.
For family coming from out of town,
we’ll be meeting at our house at 5:30 p.m.
to caravan/carpool to the restaurant.

AND NO MENTIONING THE NUMBER 29!!

Rob's REAL paper

The title of the REAL paper that Rob wrote and is getting published is entitled, "Adsorbed Fibrinogen Regulates the Behavior of Human Dendritic Cells in a CD18-Dependent Manner." I'm not sending it out because it's huge. Like 10 MB with the figures and all that.

The idea for sending out the fake paper in an e-mail was spawned late at night a month or so ago. Rob was in a funny mood and was making me laugh giving me a detailed account of why I was a house cat, all in the same manner and set-up as a real paper would be. Materials and methods, all that. I told him then that he'd have to write it out so we could tell people that was his paper. So today he spent a good 2 hours plus writing it, just to make me happy.

We're glad you all enjoyed it. If you didn't read it because you thought it was his real paper, you should read it now that I'm telling you it's not. If you're ACTUALLY interested in reading Rob's paper, e-mail me and let me know. Rob says he has smaller versions of it. But, trust me, it's not near as exciting as the fake paper we sent out.

Rob and Tamra

This is a paragraph on Rob's paper that I found on-line (just so you can see how NON-exciting the paper is):

The involvement of fibrinogen in inflammation has been considered by many, but the roles of the protein in that process have yet to be fully elucidated. The protein readily coats surfaces and is deposited at sites of inflammation. Furthermore, adsorbed fibrinogen influences many cells of the immune system, likely a result of increased receptor recognition upon ligand immobilization. To better understand adsorbed fibrinogen's role in inflammation, we studied the effects of the protein, adsorbed to the surface of microscopic beads, on human dendritic cells. Adsorbed fibrinogen increased dendritic cell expression of IL-6, IL-8, MIP-1beta and MCP-1. In contrast, solution phase fibrinogen had no effect. Importantly, dendritic cells formed complexes with, and subsequently accumulated around, beads in fibrinogen-dependent fashion. Antibodies directed against CD18 significantly decreased cytokine/chemokine expression and bead-cell complexation. Epsilon-aminocaproic acid limited bead-cell complexation, suggesting fibrinogen degradation products modulate dendritic cell activity. In support of this proposal, fibrinogen fragment D also increased MCP-1 expression by human dendritic cells. Taken together our data indicate adsorbed fibrinogen and its degradation products directly influence human dendritic cell operation. We propose a model whereby adsorbed fibrinogen plays a distinct causatory role in inflammation through its beta(2) integrin-mediated interaction with dendritic cells.

Rob's Paper Has Been Accepted!!

Rob's paper got rejected from the first journal he submitted it to: The Journal of Immunology. This was pretty sad for us. We got the rejection notice over Christmas break and it sounded pretty harsh to us. But perspective is a great thing. Rob showed the rejection to his professor, who's been around the block a few times. Retzinger's response to the rejection was that it was actually a pretty good rejection notice. They weren't attacking his research, they were just saying it wasn't important enough for their journal. As Retzinger says, "They probably think their own crap doesn't stink."

So Rob then submitted it, with minimal changes, to another journal: Experimental and Molecular Pathology. They accepted it within a week, and that's great! Rob has 2 requirements for graduation: write and defend his dissertation, and get a paper published. So, we're halfway there!

I've attached his paper for you to read if you want. Don't be worried about the technical science jargon, it's pretty read-able.

And congrats to Rob!

Tamra

ROB'S PAPER:

House Wives and House Cats:
Evidence That They are One and the Same

Robert I. Thacker
University of Cincinnati
Department of Pathology and Laboratory Medicine

Introduction

The behaviors and physical features exhibited by both house wives and house cats have long intrigued the science community. The behaviors were assumed to be coincidental, a result of thousands of years spent together in a similar environment, i.e., the principle dwelling place, but recent evidence suggests that there may be a much deeper cause to the observed similarities. Until this time these similarities have only been mentioned in passing. We felt that with the availability of DNA technology, and much more rigorous methodologies, it was time to approach this topic in greater depth. Herein we first present a thorough list of similarities between the two subjects. Second, through comparison of unique and newly discovered DNA sequences, we present undeniable evidence that house wives and house cats are the same species.

Materials and Methods

Reagents
The house cat was a gift from a local breeding colony, Schwegler Laboratories, (Cincinnati, OH). The house wife was acquired for a worthwhile fee, i.e., a ring, and a marriage vow. She is a product of Tungate Laboratories, (St. Louis, MO).

Observations of behavior and physical features
The comparative study was accomplished via direct observation. Potential similarities were recorded using digital imaging. Microscopy was used at a later time to analyze the pictures and detect the presence of any encrypted similarities.

DNA analysis
DNA was sequenced via Southern blot analysis.

Results and Discussion

Same gender and hair pattern

To begin, we made a list of all the observed similarities between the available house wife and house cat. Interestingly, one of the more prominent common features includes like gender. This link is further solidified through the fact that both test subjects exhibit hair on the top of their heads. In contrast, multiple males recruited for this study have an appreciable lack of hair in this location. Fig. 1. These observations provide a direct link between house wives and house cats and speak to the viability of our study. To our knowledge no other lab has commented on this obvious, yet important distinction.

A

B

C

Figure 1. Physical comparison between house wives and house cats. A, house cat specimen. Notice hair on top of head as well as other features described in text. B, House wife specimen. Notice hair on top of head and other features similar to house cat as described in text. C, Male specimens. Notice distinct lack of hair on top of head in all three cases.

Similar physical features and behaviors

Figure 2. House wife and house cat napping. Though the house cat is awake, it was just asleep and though they are not curled up in this example, most often a curled up position is used for these naps.

These data clearly indicate that further comparisons need not be made between adult males and house cats, and thus our attention turns solely to house wives and house cats. Both groups exhibit ears, eyebrows, eyes, a nose, teeth, and a tongue, Fig. 1. Interestingly, both groups have four white limbs, each limb terminating in fingers and toes possessing “claws” at the end of each (data not shown). Also, both love taking naps in the middle of the day, Fig. 2, often, though not always, in a curled up position.

DNA Analysis

As a final test we wanted to compare the DNA of house wives and house cats. DNA was isolated according to typical protocol and was sequenced using Southern Blot analysis. A majority of DNA was unreadable, most likely a direct reflection of the inability of males to understand the basic language of house wives and house cats, but one sequence was clear and readable, and was present in both specimens, Fig. 3. We feel that this evidence undeniably indicates that both house wives and house cats are the same species, and that species is of feline origin.

A – ACATACATACATACATACATACATACATACATACATACAT
B – ACATACATACATACATACATACATACATACATACATACAT

Figure 3. Matching region of DNA strongly indicates that the two specimens are one and the same species. A, represents sequence of DNA discovered in the house wife. B, Complimentary sequence of DNA found in the house cat. Both were found on chromosome 16 in regions previously linked to physical appearance and behavior.

Conclusions and Future Directions

This work clearly demonstrates that house wives and house cats are truly one and the same. We feel that this work will open the door to many more studies regarding the link between two beings that have always been seen as similar, yet separate, species. Our study has closed the door on one perplexing chapter of this scientific endeavor, but has opened the door to many others, for example, women often refer to men as dogs. Perhaps this is closer to the truth than many may think. We would like to pursue this study utilizing the same rigorous methods that brought such clear results in the present study. After all, the evidence is astounding, from uncleanliness to drooling. We believe that the link between men and dogs will most likely be even stronger than the link between house wife and house cat.

Elijah continues to be obsessed with Spider-Man (or Superman, another super hero that he sometimes pays attention to). A month ago, all he would wear was Spider-Man underwear. Suddenly, a few days ago, he had to wear multiple pairs of Spider-Man pajamas, and then more pairs of clothes on top of that. We couldn't figure out why until Rob asked Elijah why he was wearing so many clothes. Elijah said, "Because I'm Superman." That makes sense. Super heros hide their super hero clothes UNDER their normal clothes. :)

So these are some pictures we took of Elijah's super hero disguise. The underwear on his head is his "mask". You can see the pajamas he's wearing, but under that he has 2 other shirts on, pants, underwear and a pull-up. And check out those socks. He spent a good half hour in the bathroom, naked, putting those on. He refused help; he wanted to do it by his own self (his phrasing). I took a picture of the socks when we took them off, so you could see just how many socks he had put on. That's 7 socks on one foot and 8 on the other. Pretty impressive, I think, to get so many on by himself. He woke up upset about 2 hours after going to bed. I figured it was probably because there was no circulation getting to his toes. :)

And right now Elijah is wearing two shirts that I can see. On the bottom half is a pair of pants with THREE pairs of shorts and underwear under that. Fun times raising a 3 year old.

Enjoy.

Tamra

UPDATE:
When Rob changed Elijah's clothes to get him ready for bed, there were FOUR pairs of shorts under those pants, not just three.

Rob asked him why he was wearing all the clothes today. Elijah said, "Cause I HAVE to. It's comfy." :)

A Long Series of Pictures, part 2

C made the grandkids all hats for Chrsitmas. They turned out really cute. We got Teancom to pose with his hat on.

One of Elijah's Santa gifts was a Spider-Man camping chair. He loves it. We actually left it up in Toledo because we were packing it up and Elijah wanted to play with it some more. He put it in a corner, we couldn't find it, and we left without it.

This is Elijah trying to sit in his Spider-Man chair at the table to eat breakfast.

Here's a random picture of Christmas morning. I'm pretty sure it's me helping Elijah get out his Spider-Man chair. But it shows a little of the morning chaos, people everywhere and running around crazy. Miciah pretty much did her own thing with the cousins. Elijah stayed near us and we helped him along the way. And Teancom just sat on my lalp and chilled. Also, the picture is included because Rob got me those pajamas for Christmas. A super-fuzzy robe came with the gift and I love it! I usually walk around the house in winter with a blanket around me. The robe is WAY easier.

And the last picture, sort of the culmination of the holidays, is of the 5 Thacker siblings. They spent like 10 minutes just laying there, taking pictures on cell phones. I got a bunch of pictures out of it, as well as a video of them just goofing around. ... Having all of the family together made it a very memorable Christmas.

We love you all!

A long series of pictures, part 1

Okay, the promised pictures.

Starting us off is the Spider-man obsession. Somewhere in the house Elijah found rope. He decided it was his web and spent about a week putting the webs everywhere (I finally threw the rope away. It was trashed, and we'd had to cut it several times because it had been knotted so tightly and crazily around things).

These pictures don't show off his most impressive web, but I just like what's highlighted in one of the pictures: my wooden spoon from the kitchen. One of Elijah's other obsessions? Taking all my kitchen stuff out of the kitchen and playing with it. I just love the imagery of the wooden spoon helplessly dangling from the web. It makes me smile.

This brings up another good story about Elijah. I told you that he's been making messes and piles with everything. It cutely drives me nuts. It's not a big deal, but it's hard to keep the house clean when he does it to EVERYTHING IN THE HOUSE. He'll often trash one room, then, when it's trashed, move on to the next room. One day he was doing just this to my clean living room (why do we clean things again?). He looked right into my eyes and said, "Mom, I make mess." Not like a confessional, but like an announcement. And it dawned on me that he's been making messes just cause he likes to! I guess I should have known that.

It has prompted us to start making the kids clean the house with us. Up to this point, I've kind of done it myself, thinking it was more stressful to clean with the kids. Sometimes that's still true. But we'll get done with dinner and the next order of business is to clean the house. It works great! Should have thought of it forever ago. The kids clean the living room with Rob and I clean the kitchen and dining room. Then we'll use the clean room to do quiet bedtime things. Sometimes we'll watch a show (Avatar lately--good motivation), or read books. It's made bedtime go smoother, too.

On to the pictures! Notice Elijah's fingers webbing the camera. This features big in most of our other pictures, too. In fact, almost every picture of Elijah that I send out today has at least one version with the webbing fingers.

This is the picture of the Christmas tree with all the presents under it. Rob's sisters arranged all the presents all beautifully. I would have just tossed them under, but holy cow, how cool it turned out!

Also, because there was a no spending money rule for Thacker Christmas (genius idea), we made C a nativity. C collects nativities and lately she's been looking for some of the more unusual and unique ones. I thought, what's more unique than one done by family? I had the idea and the finished product turned out more beautiful than I had thought. I thought it was a good idea, but the finished product was GENIUS! Rob rigged a stable together, and Miciah did all the artwork. She practiced for days. She'd say, "Mom, I don't know how to draw an ox. I'll go look at your nativity." :) And then she'd study the ox. She also said, "Mom, I don't know how to draw Mary sitting. So I'll just draw a bench under her." :) The angel is a Gloria angel, just like in my nativity (and looks dang close to it, too). Anyways. It was all made out of paper and we then scanned in all the images (not going to lose that!), and it's a good thing we did. Because we borrowed someone's laminator to laminate all the pieces, and the laminator ate up 2 of the pieces!! So we were able to print them off the computer.

C loved the nativity and it's now being displayed in her home.

Pictures of Miciah and Elijah opening gifts. Check out Elijah holding his Thomas toy with one hand and webbing with the other.

And the picture with Elijah's hand in the camera cracks me up. The minute I get out the camera, Elijah starts getting up with his face in it or starts webbing and tilting his head (why the tilt?). So this one says a lot.

Tamra

Finally an Update

It's been a month since my last update. That seems like a long time to me, especially since we had Christmas and New Years in there! So here's our family update.

It seems like December was a long month in some ways, and just not long enough in other ways (like prep time for Christmas--can you ever have enough prep time?). At the start of December we decided on 2 things. The first was that we were going to go up early to Rob's parents' house and surprise them and B and G who were going to be there by themselves for a few days. We thought it'd be a lot of fun. The second thing we decided was to make a board game for C. Between fastforwarding our Christmas prep time and spending 50 hours making that board game, the week before Christmas was STRESSFUL!!!!!! We got little sleep and spent every available minute getting things done so we could leave Sunday to go to P.

Long story short, the board game turned out pretty cool. We're proud of it, anyways. We have yet to make a second game board (for us, of course), but we'll get to it. We won't try to pull it off the week before Christmas, though.

And going up to P on Sunday actually ended up working really really well. We had told V over Thanksgiving that we would be coming up early, but had let it be a surprise to everyone else. I actually was telling at least 1 lie to everyone involved with the Thacker Christmas. For an entire month. Anyways, when we arrived on Sunday, V was just as surprised as everyone else to see us. He'd forgotten. :) So it was fun to pull off a complete surprise.

Our surprise showing prompted Rob's sisters and their families to join us earlier than they had planned, too. They came up Christmas Eve late in the night and surprised Rob's parents. That was fun, too. We got both surprises on video.

Christmas morning was HUGE. None of us had huge Christmases, but when you combine them all, there were a TON of presents under this huge tree. The tree was cut out of their backyard and was something like 15 feet tall. We took pictures of it with the presents underneath. But I'll have to download the pics off Rob's laptop, so the pictures will have to come a little later. I'm behind, what can I say.

My favorite gift was the one we got from B. Everyone should e-mail him and ask him what it was. My second favorite gift was a freezer from my Mom. I really like having a freezer downstairs. Yea for freezer space! After that it was probably the Transformers special edition movie (the special features of how they did the special effects. Simply awesome), and two coloring books from J. Not for my kids, for Rob and me (he gave the kids their own). One is Color Your Own Abstract Art Masterpieces. The other is Color Your Own Van Gogh Paintings. They give you the outlines and let you color it yourself. How cool is that?!!

Santa and Rapunzel

So that was Christmas. A cute story about Christmas. Miciah only asked Santa for 2 things: The Barbie as the Island Princess movie, and the cereal, too. That's it. Easy enough. She asked us for the REST of the Barbie movies. :) We got her some, including the Rapunzel movie that she'd lost (we have the cover, but not the disc inside) months ago. When we were wrapping the gifts, Rob decided to wrap the Rapunzel movie as a Santa gift and he wrote a little note on it from Santa saying, "This is to replace the one you lost." We left the rest of the Barbie movies we bought at home to open when we got back. So on Christmas Eve in Toledo, at bedtime, Miciah said to Rob, "Daddy, I thought of something else I wanted to ask Santa for." Rob explained that it was pretty late to ask Santa for anything, but what was it. She said, "I want to ask him for a new Rapunzel movie to replace the one I lost." Rob repeated that it would be pretty hard to do at this point. She said, "Maybe Santa could put a chimney in a store and go buy one!" So you could imagine how magical it was when Miciah got the Rapunzel movie from Santa on Christmas morning. And I don't care if you like/believe in Santa or not, that IS pretty magical.

A funny end note to the story: When Miciah told her cousin, A, about getting the Rapunzel movie, and she showed it to her, A said, "We have that at our house." :) Turns out that the missing movie has been safely recovered at the S house. We told them that they could keep it. We'd even give them the cover for it. Merry Christmas to all.

7th Anniversary

Our anniversary was on the 21st. Rob and I celebrated 7 years together. It's been an interesting 7 years, with so many changes for both of us (3 kids, college, grad school, etc.). This last year has been one of the hardest of our marriage, but all I can say is that if that's the hardest it gets, we're safe. Let us pray the fates will not start a competition to see which year can be worse. :) I was exhausted for our anniversary date, so we cancelled other plans and Rob made me a cute dinner at home. Our 3 kids were being watched overnight by 2 families (it pays to have friends). You'd think we'd use the time to stay up late together doing something romantic. What did we do? First, after dinner I took a nap (no joke). Then we watched a chick flick while we finished wrapping Christmas gifts on the living room floor. Before all that, Rob had cleaned the house for me. And that's what the culmination of 7 years of marriage looks like--skip the romance, give me something practical: a nap, a clean house, and finishing the presents.

Rob did give me something really really cute. Before the dinner he sent me on a treasure hunt. I was tired and hungry and half annoyed that he wouldn't let me eat yet, but it was cute. At a few steps I discovered something he had set out for the night: my wedding dress (he wore his tux and I wore my dress for our dinner), our traditional sparkling cider and cheesecake. Then, the last clue lead to the big flower pot that was sitting out in our garage for the winter. I was pretty annoyed at this point, actually, that he'd made me go outside (insanely tired and hungry Tamra is not a docile creature). And then he buried the treasure. Except I'd missed that it was "treasure" I was digging for. I thought I was digging for another clue. He'd printed out the clues on a strip of paper about 1/2 inch in height and folded in fourths. I thought I was outside, digging in the flower pot with a shovel, in the middle of winter, to find another clue!! I was mad (I mean, seriously, can you visualize what I thought was happening?). Rob told me to read the clue again, it said I was digging for treasure!

The treasure turned out to be a blue topaz necklace (December's birthstone) with matching earrings. I actually really really like the color. It's a color that I wear all the time as an accent color. I have shirts that are that color. And the birthstone for December (when our marriage was born)--that's just cute. So it was a lovely night.

New Years Eve

New Years Eve was crazy. We have hosted the world's smallest New Years Eve party for a few years running. I think this was our last year for a while. I think I'm a little burned out. Though we may transition it to a New Years Day party. We spent New Years Day with the T's at our house playing the Wii. Convinced us that someday we would like to own one. We put it on our wish list. Miciah asked if we could get one next Christmas. I told her maybe. Then she said, "I'll sell some of my toys to get one." :) Even if she was willing to do that, I have doubts that she owns a saleable $300 in toys.

This last Friday the youth group at church did their non-NYE party. In the past they've done a New Years Eve party, but it got to be a hassle, and the new bishop thinks NYE is a family holiday (go figure), so they switched it to the Friday after NYE. Genius! It was a lot of fun. We played ping-pong, volleyball, and pin guard (a game the Scouts play a lot--kind of a dodgeball type of game), and ate pizza and chips and other goodies. It was fabulous fun. Again, another date night with the kids being watched overnight by friends. Yea for friends!! We watched their kids later on Saturday night, so it worked out well.

Our Furnace, A Saga

Saturday we got a furnace technician to come look at our furnace that we'd been thinking was going to burn down our house. For the last few months it was been exploding. That's the best way to describe it. Like it had an overabundance of gas and then it would do a very loud, chest-rumbling bang, and then the fire alarm would go off for a few seconds. Miciah was downstairs to see it once (she's the only one that's seen it at the time it does it) and she described to Rob that the flame came out about a foot and a half. Scary. Anyways, the guy came and checked it out. He cleaned the starters (is that what they're called?) off. Said usually the problem is from one of them being dirty and them not lighting evenly, so the gas keeps turning on. Then he turned down our gas pressure which he said was way too high (who knows these things?). Before he came, every time the furnace came on, whether it exploded or not, it would do this click, click, click sound. Many times. And since Saturday, I haven't even noticed my heater coming on. Yea for non-burned down houses!!

This is a long update. Clearly I haven't written for a while.

Avatar

Our family has been enjoying watching Season 2 of Avatar. C loaned us all the movies (in exchange for a Transformers borrow), and we've been watching those for the last week. It's a fun show. Miciah now talks to her friends about bending, and Elijah likes to pretend he's Aang, the Avatar. He'll come up to me and say, "Mom, I'm the Avatar. 'WHERE'S APA?'" That's a direct quote from chapter 11.

The Kids

Miciah and Elijah are cute as siblings. They alternate between loving each other dearly and bugging each other deeply. :) A fun story from a few days ago. Miciah was sitting on the couch and Elijah was standing in front of the couch. Miciah did something that Elijah didn't like. Suddenly, and with distress in her voice, Miciah said, "Elijah's trying to break down the house by breaking the couch!!" Rob and I stared at her in disbelief, without expression. She said matter-of-factly, "Really. He IS." SO funny. Then Elijah continued hitting the couch arm. Hard. Rob said, "Doesn't that hurt you?" Elijah said, "Not hurt my hand. Hurt the couch." :) Okay. He did explain to us that while he was trying to break the couch to hurt Miciah, Rob and I were not the object of his frustration and he wasn't trying to hurt us.

Elijah is a funny kid. While he can get really mad and somewhat aggressive, he rarely hurts others. He'll get mad and hit something else. He'll get mad and web you with his Spider-Man powers. But he usually doesn't hurt people.

Which reminds me of Christmas week's funniest story. Rob and I were playing racquetball, so the other adults were watching our kids. Elijah was standing in front of the TV so no one else could see. C asked him to move and for a little while he ignored her. She asked again and he turned around, like in slow-motion, glaring at her. He then, in the same slow-motion, brought out his web and webbed her. After they got done laughing, C picked Elijah up (because he still wouldn't move) and put him on the couch. He kept watching the show, but the whole time he kept his arm out towards C, webbing her, and he'd turn periodically to glare at her. :) That's just funny.

Teancom

Teancom is doing great. He is now walking near-exclusively, though he's still not incredibly stable on his feet. He has JUMPED in his verbal skills. Where before I couldn't think of 3 words he could say, he now says, "ma ma", "da da", "uh huh", "uh uh", "no", "here you go" (not that clear, of course), "please" (we can get him to say it occasionally), "thank you" (he says it often), "bye bye", "night night", "Cleo" (ee-oh), "Elijah", and "Leah" (his friend). So far Miciah doesn't have a name, that I can gather. He knows who Miciah is, but I've never heard him say her name. It's fun to have him so verbal, and it's very helpful! Yea for talking.

We took Teancom to nursery on Sunday for some transition time. He goes in officially the last Sunday of this month. He did great. I told Rob this and he said, "You're surprised?" No. He's just a good kid. He did get pushed over by one kid (there's a little boy who appears to have something out for Teancom. He's been picking on him for half a year or so), but no big deal. It got to clean up time. I thought he might be upset about putting his toys away. Nope. I asked him to put his car in a bin. He did it right away. He had a book. I asked him to give it to the leader. And he STOOD IN LINE behind 4 other kids with the book held up to give her. That blows me away. He's such a weird kid. He's quiet. He likes books. We can read him a full book. Not like a one-word-a-page book. A full easy reader book (like a Dr. Suess). Just so mellow. It occured to me while I was at nursery, that parents who only have kids like Teancom probably think that kids like Miciah and Elijah are monsters/broken and that parents of kids like Miciah and Elijah are awful parents!! It makes me grateful to have Teancom after the first two. It's not only a nice breather, but it's good perspective.

If you've read to this point, thank you for devoting the last hour of your life to reading my update. Your special reward is being mailed to you and you'll receive it in 1 - 6 weeks.

I'll try to get on top of sending out some of our cute pictures from the last few weeks!

We love you all and hope you all had memorable, lovely holidays!

Tamra, Rob, Miciah, Elijah, and Teancom